[ecdc homepage]     [ECDC Find Complement]

ecdc Comments to program: Find Complement

 
For input a nucleotide sequence is expected strictly consisting of letters
a, c, g, t    or    
r y p q h s j k l m n
a   a     a   a a a a
  c   c   c c   c c c
g     g g   g g   g g
  t t   t   t t t   t
Blancs inbetween will be automatically eliminated. e.g. 
ttaaactaaaacccagggatgactgatcccggaaagcaacattgccaccagcacgacttcggagttgccgggtaat
agtgtagcgctgagaaaactactggcaaacaacgagaaaagcgataacgcttcactcat

or
                            TTAAACTAA AACCCAGGGA TGACTGATCC CGGAAAGCAA
     CATTGCCACC AGCACGACTT CGGAGTTGCC GGGTAATAGT GTAGCGCTGA GAAAACTACT
     GGCAAACAAC GAGAAAAGCG ATAACGCTTC ACTCAT
The output is possible in 2 directions and 7 modes:    1   2   3   4   5   6   7
Reverse Complement:
Forward Normal: 		as shown under 1) - 7)
is a possibility of new blocking the original strand using layout 1) - 7)
For the output you have the choice between 7 different modes:
  1) 15 blocks of 3 nucleotides per line without numbering: 
atg agt gaa gcg tta tcg ctt ttc tcg ttg ttt gcc agt agt ttt
ctc agc gct aca cta tta ccc ggc aac tcc gaa gtc gtg ctg gtg
gca atg ttg ctt tcc ggg atc agt cat ccc tgg gtt taa
  2) 6 blocks of 10 nucleotides per line without numbering: 
atgagtgaag cgttatcgct tttctcgttg tttgccagta gttttctcag cgctacacta
ttacccggca actccgaagt cgtgctggtg gcaatgttgc tttccgggat cagtcatccc
tgggttttag tttaa
  3) 6 blocks of 10 nucleotides per line with automatical numbering in front of of the line:
You just have to type in the number of the first nucleotide (here: 6020). 
  6020                       a tgagtgaagc gttatcgctt ttctcgttgt ttgccagtag
  6061   ttttctcagc gctacactat tacccggcaa ctccgaagtc gtgctggtgg caatgttgct
  6121   ttccgggatc agtcatccct gggttttagt ttaa
  4) 6 blocks of 10 nucleotides per line with automatical numbering at the end of the line:
You just have to type in the number of the first nucleotide (here: 6020). 
                    a tgagtgaagc gttatcgctt ttctcgttgt ttgccagtag     6060
ttttctcagc gctacactat tacccggcaa ctccgaagtc gtgctggtgg caatgttgct     6120
ttccgggatc agtcatccct gggttttagt ttaa                                 6154
  5) 6 blocks of 10 nucleotides per line with individual numbering in front of the line:
You have to type in
- the number which you wish to appear in front of the second line (here: 6064) and
- the starting position of your first nucleotide (here: 17).
  The starting position must be a number between 1 and 60. 
 
         1   5   10      17 20         30         40         50         60
         |---+----| |---+-*--| |---+----| |---+----| |---+----| |---+----| 
  6004                    atga gtgaagcgtt atcgcttttc tcgttgtttg ccagtagttt 
  6064   tctcagcgct acactattac ccggcaactc cgaagtcgtg ctggtggcaa tgttgctttc
  6124   cgggatcagt catccctggg ttttagttta a
  6) 6 blocks of 10 nucleotides per line with individual numbering at the end of the line:
You have to type in
- the number which you wish to appear at the end of the first line (here: 6063) and
- the starting position of your first nucleotide (here: 17).
  The starting position must be a number between 1 and 60. 
 
1   5   10      17 20         30         40         50         60
|---+----| |---+-*--| |---+----| |---+----| |---+----| |---+----| 
                 atga gtgaagcgtt atcgcttttc tcgttgtttg ccagtagttt     6063
tctcagcgct acactattac ccggcaactc cgaagtcgtg ctggtggcaa tgttgctttc     6123
cgggatcagt catccctggg ttttagttta a                                    6154
  7) 1 contiguous block: 
atgagtgaagcgttatcgcttttctcgttgtttgccagtagttttctcagcgctacactattacccggcaactcc
gaagtcgtgctggtggcaatgttgctttccgggatcagtcatccctgggttttagtttta

Send comments to : Manfred Kröger kroeger@bio.uni-giessen.de
webmaster | updated: